НАУКА ОБРАЗОВАНИЯ - издательский дом

Switch to desktop

Главная

РАЗРАБОТКА ПЦР-ТЕСТ-СИСТЕМЫ ДЛЯ ИДЕНТИФИКАЦИИ STREPTOCOCCUS SPP

 

Журнал «НАУЧНАЯ ЖИЗНЬ»  [СКАЧАТЬ СТАТЬЮ В PDF]
ТОМ 19, ВЫПУСК 5, 2024 

Рубрика: ИНФЕКЦИОННЫЕ БОЛЕЗНИ И ИММУНОЛОГИЯ ЖИВОТНЫХ
DOI: 10.35679/1991-9476-2024-19-5-925-934
   
Для цитирования:

Сульдина Е. В., Мерчина С. В., Молофеева Н. И., Калдыркаев А. И., Нафеев А. А., Савина Е. В. Разработка ПЦР-тест-системы для идентификации Streptococcus spp. // Научная жизнь. 2024. Т. 19. Вып. 5 (137). С. 925–934. DOI: 10.35679/1991-9476-2024-19-5-925-934

   
Авторы: 

Сульдина Екатерина Владимировна, ст. преподав. кафедры «Микробиология, вирусология, эпизоотология и ветеринарно-санитарная экспертиза», ФГБОУ ВО «Ульяновский государственный аграрный университет им. П. А. Столыпина»: Россия, 432017, Ульяновская обл., г. Ульяновск, бульвар Новый Венец, 1.
Мерчина Светлана Васильевна, канд. биол. наук, доцент, доцент кафедры «Микробиология, вирусология, эпизоотология и ветеринарно-санитарная экспертиза», ФГБОУ ВО «Ульяновский государственный аграрный университет им. П. А. Столыпина»: Россия, 432017, Ульяновская обл., г. Ульяновск, бульвар Новый Венец, 1.
Молофеева Надежда Ивановна, канд. биол. наук, доцент, доцент кафедры «Микробиология, вирусология, эпизоотология и ветеринарно-санитарная экспертиза», ФГБОУ ВО «Ульяновский государственный аграрный университет им. П. А. Столыпина»: Россия, 432017, Ульяновская обл., г. Ульяновск, бульвар Новый Венец, 1.
Калдыркаев Андрей Иванович, канд. биол. наук, доцент, доцент кафедры «Микробиология, вирусология, эпизоотология и ветеринарно-санитарная экспертиза», ФГБОУ ВО «Ульяновский государственный аграрный университет им. П. А. Столыпина»: Россия, 432017, Ульяновская обл., г. Ульяновск, бульвар Новый Венец, 1.
Нафеев Александр Анатольевич, д-р мед. наук, доцент, профессор кафедры «Микробиология, вирусология, эпизоотология и ветеринарно-санитарная экспертиза», ФГБОУ ВО «Ульяновский государственный аграрный университет им. П. А. Столыпина»: Россия, 432017, Ульяновская обл., г. Ульяновск, бульвар Новый Венец, 1.
Савина Елена Владимировна, канд. с.-х. наук, доцент кафедры «Морфология и физиология, кормление, разведение и частная зоотехния», ФГБОУ ВО «Ульяновский государственный аграрный университет им. П. А. Столыпина»: Россия, 432017, Ульяновская обл., г. Ульяновск, бульвар Новый Венец, 1.

 

Тел.: (842-2) 55-95-47
E-mail: e.suldina2006@yandex.ru

   
Реферат: 

В данной работе приведены результаты исследований по разработке системы праймеров и зонда для идентификации бактерий рода Streptococcus spp методом полимеразной цепной реакции (ПЦР) в режиме реального времени. В ходе работ отобрано 68 образцов объектов санитарного надзора из личных подсобных и крестьянско-фермерских хозяйств Ульяновской области и близлежащих регионов. С использованием бактериологических методов выделено и идентифицировано 4 штамма бактерий Streptococcus spp., являющихся возбудителями бактериозов у птиц, которые стали основой для дальнейших экспериментов. Определены оптимальные параметры выделения ДНК бактерий Streptococcus spp. и проведена оценка эффективности ее очистки. В рамках исследований проанализирован геном Streptococcus pyogenes, и установлен участок ДНК, являющийся по поданным in-silico общим для представителей Streptococcus spp и ответственным за катализ связывания аминоацил-тРНК с рибосомой. К выбранному уникальному региону референс-штамм Streptococcus pyogenes strain NCTC12064: 1,424,599..1,425,795 п.н. подобраны специфические олигонуклеотиды (прямой праймер (f) 5’-3’ TCTACGGCGATTGGGTGGAT; обратный праймер (r) 3’-5’ GAAGGTGGGCGTCACACTCC) и зонд (GCTGGAAGTTCGATTGAACCTG, флуоресцентный краситель FAM, гаситель BHQ-1). Определена оптимальная концентрация праймеров (5 пмоль) и проб (0,4 пмоль). В проведённых экспериментах система праймеров продемонстрировала 100% специфичность при тестировании на гетерологичных штаммах бактерий и чувствительность равную 100 клеткам/мл. Полученные при апробации результаты подтверждают эффективность предложенного метода для быстрой и точной идентификации бактерий Streptococcus spp, что имеет важное значение для микробиологической диагностики и контроля инфекций.

   
Ключевые слова: Streptococcus spp., птица, бактерии, патоген, полимеразная цепная реакция, ПЦР-РВ, праймер, зонд
   

Список литературы:

1. Pet birds as potential reservoirs of virulent and antibiotic resistant zoonotic bacteria / H. A. Ahmed, N. F. Awad, M. I. Abd El-Hamid et al. // Comparative Immunology, Microbiology and Infectious Diseases. – 2021. – Т. 75. – 101606. doi: 10.1016/j.cimid.2020.101606

2. Streptococcus dentisani is a common inhabitant of the oral microbiota worldwide and is found at higher levels in caries-free individuals / H. D. López-Santacruz, A. López-López, A. Revilla-Guarinos, et al. // International Microbiology. – 2021. – Т. 24(4). – P. 619–629. doi:10.1007/s10123-021-00222-9
3. Sulfated vizantin inhibits biofilm maturation by Streptococcus mutans / M. Oda, M. Kurosawa, H. Yamamoto, et al. // Microbiology and Immunology. – 2020. – С. 64. – P. 493–501. doi:10.1111/1348-0421.12797
4. Identification and molecular characterization of Staphylococcus aureus and multi-drug resistant MRSA from monkey faeces in China / Li, Y., et al. // Transboundary and Emerging Diseases. – 2020. – Т. 67. – № 3. – P. 1382–1387. doi: 10.1111/tbed.13450
5. The effect of Streptococcus salivarius k12 on halitosis: a double-blind, randomized, placebo-controlled trial / L. He, H. Yang, Z. Chen, X. Ouyang, // Probiotics and Antimicrobial Proteins. – 2020. – Т. 12(4). – Р. 1321–1329. doi: 10.1007/s12602-020-09646-7
6. Comparative analysis of fecal bacterial microbiota of six bird species / L. Gao, L. Liu, C. Du, Q. Hou, // Frontiers in Veterinary Science. – 2021. – Т. 8. – 791287. doi: 10.3389/fvets.2021.791287
7. First report of fecal microflora of wild bar-headed goose in Tibet Plateau / S. Dong, S. Xu, J. Zhang, et al. // Frontiers in Veterinary Science. – 2022. – Т. 8. – 791461. doi: 10.3389/fvets.2021.791461
8. Mladenov G., Popova T. P. Problematic infections in parrots: Streptococcal and Enterococcal infections, diagnostics and control // Tradition and Modern Veterinary Medicine. – 2020. – Т. 5. – P. 65–72.
9. Streptococcosis in commercial and noncommercial avian species in California: 95 cases (2000–2017) / M. Crispo, H. L. Shivaprasad, G. L. Cooper, A. A. Bickford, S. T. Stoute // Avian Diseases. – 2018. – Т. 62(2). – P. 152–162. doi: 10.1637/11765-103117-Reg.1.
10. Isolation, identification and antibiogram of cloacal flora from apparently healthy caged zoo birds / Golaviya A. V., et al. // Indian Journal of Veterinary Sciences and Biotechnology. – 2023. – Т. 19. – № 1. – P. 38–42. doi: 10.48165/ijvsbt.19.1.09
11. Comparison of the gut microbial communities of domestic and wild mallards (Anas platyrhynchos) based on high-throughput sequencing technology / Y. He, M. Zhang, C. Dai, L. Yu // Animals. – 2023. – Т. 13. – № 18. – Р. 2956. doi: 10.3390/ani13182956
12. Shehata A. A., Hafez H. M. Streptococcosis // Turkey Diseases and Disorders Volume 1: Bacterial and Fungal Infectious Diseases. – Cham: Springer International Publishing, 2024. – Р. 185–188. doi: 10.1007/978-3-031-63318-8_18

   
English version:

DEVELOPMENT OF A PCR TEST SYSTEM FOR IDENTIFICATION OF STREPTOCOCCUS SPP.

 

Suldina Ekaterina Vladimirovna, Senior Lecturer, Depart. of Microbiology, virology, epizootology and veterinary and sanitary examination, Ulyanovsk state agrarian university named after P.A. Stolypin, Ulyanovsk, Russia.
Merchina Svetlana Vasilyevna, Cand. of Biol. Sci., Ass. Prof., Ass. Prof. of the Depart. of Microbiology, virology, epizootology and veterinary and sanitary expertise, Ulyanovsk state agrarian university named after P.A. Stolypin, Ulyanovsk, Russia.
Molofeeva Nadezhda Ivanovna, Cand. of Biol. Sci., Ass. Prof., Ass. Prof. of the Depart. of Microbiology, virology, epizootology and veterinary and sanitary expertise, Ulyanovsk state agrarian university named after P.A. Stolypin, Ulyanovsk, Russia.
Kaldyrkaev Andrey Ivanovich, Cand. of Biol. Sci., Ass. Prof., Ass. Prof. of the Depart. of Microbiology, virology, epizootology and veterinary and sanitary expertise, Ulyanovsk state agrarian university named after P.A. Stolypin, Ulyanovsk, Russia.
Nafeev Alexander Anatolyevich, Dr. of Med. Sci., Ass. Prof., Prof. of the Depart. of Microbiology, virology, epizootology and veterinary and sanitary examination, Ulyanovsk state agrarian university named after P.A. Stolypin, Ulyanovsk, Russia.
Savina Elena Vladimirovna, Cand. of Agr. Sci., Ass. Prof. of the Depart. of Morphology and physiology, feeding, breeding and private animal science, Ulyanovsk state agrarian university named after P.A. Stolypin, Ulyanovsk, Russia.

 

Keywords: Streptococcus spp, poultry, bacteria, pathogen, polymerase chain reaction, PCR-RV, primer, probe.

 

Abstract. This paper presents the results of research on the development of a primer system and a probe for the identification of bacteria of the genus Streptococcus spp by polymerase chain reaction (PCR) in real time. During the work, 68 samples of sanitary supervision facilities were selected from private subsidiary and peasant farms of the Ulyanovsk region and nearby regions. Using bacteriological methods, 4 strains of Streptococcus spp. bacteria, which are pathogens of bacteriosis in birds, were isolated and identified, which became the basis for further experiments. The optimal parameters of DNA isolation of Streptococcus spp. bacteria were determined and the effectiveness of its purification was evaluated. As part of the research, the Streptococcus pyogenes genome was analyzed, and a DNA region was identified, which, according to in-silico data, is common to representatives of Streptococcus spp and responsible for the catalysis of aminoacyl-tRNA binding to the ribosome. The reference strain of Streptococcus pyogenes strain NCTC12064: 1,424,599 belongs to the selected unique region. 1,425,795 bp. specific oligonucleotides were selected (direct primer (f) 5’-3’ TCTACGGCGATTGGGTGGAT; reverse primer (r) 3’-5’ GAAGGTGGGCGTCACACTCC) and probe (GCTGGAAGTTCGATTGAACCTG, fluorescent dye FAM, extinguisher BHQ-1). The optimal concentration of primers (5 pmol) and samples (0.4 pmol) was determined. In the experiments conducted, the primer system demonstrated 100% specificity when tested on heterologous bacterial strains and sensitivity equal to 100 cells/ml. The results obtained during testing confirm the effectiveness of the proposed method for the rapid and accurate identification of Streptococcus spp bacteria, which is important for microbiological diagnosis and infection control.

   
   For citation: Suldina, E.V., Merchina, S.V., Molofeeva, N.I., Kaldyrkaev, A.I., Nafeev, A.A., Savina, E.V. (2024) Development of a PCR test system for identification of Streptococcus spp. Nauchnaya zhizn' [Scientific Life], vol. 19, iss. 5 (137), pp. 925–934. (in Russian) DOI: 10.35679/1991-9476-2024-19-5-925-934

 

К содержанию»